SubtiBank SubtiBank
yloN

yloN

similar to rRNA adenosine methyltransferase for modification of 23S rRNA
locus
BSU_15750
pI
6.79
mw
41.41 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
function
rRNA modification
product
rRNA methyltransferase
essential
no
synonyms
rlmN

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    1,649,286 1,650,377

    The protein

    Catalyzed reaction/ biological activity

  • methylates C-2 in A2503 in 23S rRNA and A37 in tRNA [pubmed|23752511]
  • adenosine2503 in 23S rRNA + 2 reduced [2Fe-2S]-[ferredoxin] + 2 S-adenosyl-L-methionine --> 2-methyladenosine2503 in 23S rRNA + 5'-deoxyadenosine + L-methionine + 2 oxidized [2Fe-2S]-[ferredoxin] + S-adenosyl-L-homocysteine (according to UniProt)
  • adenosine37 in tRNA + 2 reduced [2Fe-2S]-[ferredoxin] + 2 S-adenosyl-L-methionine --> 2-methyladenosine37 in tRNA + 5'-deoxyadenosine + L-methionine + 2 oxidized [2Fe-2S]-[ferredoxin] + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|3RF9] (from E. coli, 38% identity) [pubmed|21527678]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]
    description
    [Pubmed|16964327]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16964327], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]-[gene|2B67C63442F28F6BCBA3BA6DE4B563C73E8DF16C|yloI]-[gene|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|priA]-[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]

    description

  • [pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B132 (yloN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1131 NBRP B. subtilis, Japan]
  • 1A819 ( ''yloN''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A819&Search=1A819 BGSC]
  • BKE15750 ([gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTATTAAGTTCTGCCA, downstream forward: _UP4_CAAGACGAGACGAGGTGATG
  • BKK15750 ([gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTATTAAGTTCTGCCA, downstream forward: _UP4_CAAGACGAGACGAGGTGATG
  • References

  • 18025251,18307109,27496281,23752511,11918677,21527678