SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


anti-adaptor protein, inhibits [protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|YjbH], responsible for stabilization of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] in response to cell wall stress
6.60 kDa
protein length
gene length
165 bp Sequence Blast
control of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] proteolysis
anti-adaptor protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • Gene

    3,387,781 3,387,945

    The protein

    Catalyzed reaction/ biological activity

  • prevention of the [protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|YjbH]-[protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] interaction [Pubmed|21378193]
  • Structure

  • [PDB|5BRQ] (from B. licheniformis, 29% identity) [pubmed|26894535]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1D6C340264B8A75727E202AD2E37053091C94013|YuxN]: repression, [pubmed|30001325], in [regulon|1D6C340264B8A75727E202AD2E37053091C94013|YuxN regulon]
  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]: activation, CssR-P acts as anti-repressor [pubmed|30001325], in [regulon|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR regulon]
  • regulation

  • induced by vancomycin ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]-P) [pubmed|30001325]
  • induced by cell wall stress ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]) [pubmed|30001325]
  • view in new tab

    Biological materials


  • BKE33029 ([gene|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|yirB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATTCACCCTTTC, downstream forward: _UP4_TAAAAAAATAGACTGCAAAA
  • BKK33029 ([gene|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|yirB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATTCACCCTTTC, downstream forward: _UP4_TAAAAAAATAGACTGCAAAA
  • References


  • 23375660
  • Research papers

  • 21378193,30001325,26894535