SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


probably part of the stressosome
31.96 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
control of SigB activity
RsbR paralog

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    2,120,767 2,121,615

    The protein

    Paralogous protein(s)

  • [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB]
  • [SW|Domains]

  • [SW|STAS domain] (aa 165-276) (according to UniProt)
  • Modification

  • phosphorylation on Thr-186 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|21362065]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A323 (yojH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19450 ([gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCATGATTGATCACC, downstream forward: _UP4_TAAGGCTTAAGGCCTTATAC
  • BKK19450 ([gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCATGATTGATCACC, downstream forward: _UP4_TAAGGCTTAAGGCCTTATAC
  • References

  • 15312768,17726680,17726680,17218307,20019076,28271471,28727759