SubtiBank SubtiBank
sweD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sweD

cofactor of the [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX] complex
locus
BSU_24930
pI
5.05
mw
13.18 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast
function
control of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] activity in peptidoglycan elongation
product
cofactor of the [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX] complex
essential
no
synonyms
yqzD

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,576,367 2,576,720

    Phenotypes of a mutant

  • synthetically lethal with [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|LytE], this can be suppressed by point mutations in [gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE] or [gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX] [pubmed|31437162]
  • cells are shorter and fatter than wild-type, cells are bent and curved, both phenotypes depend on the presence of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] [pubmed|31437162]
  • The protein

    [SW|Localization]

  • cell membrane (integral), C-terminal cytoplasmic domain [pubmed|31437162]
  • Expression and Regulation

    Operons

    genes
    [gene|5F184E491602D548AAE8E6D598BB742513770F73|sweD]-[gene|0BC657B63EE124B17FDA7914262E706B2CC9ABC1|sweC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-C483 (yqzD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2481 NBRP B. subtilis, Japan]
  • BKE24930 ([gene|5F184E491602D548AAE8E6D598BB742513770F73|sweD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCATCACCTTCTAT, downstream forward: _UP4_AAAGATAATGAGAAGGTGCT
  • BKK24930 ([gene|5F184E491602D548AAE8E6D598BB742513770F73|sweD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCATCACCTTCTAT, downstream forward: _UP4_AAAGATAATGAGAAGGTGCT
  • References

  • 14651647,26883633,31437162