SubtiBank SubtiBank
sigG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sigG

[SW|RNA polymerase] [SW|sporulation] forespore-specific (late) [SW|sigma factor] SigG
locus
BSU_15330
pI
5.50
mw
29.92 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
function
transcription of [SW|sporulation] genes (late forespore)
product
[SW|RNA polymerase] [SW|sporulation] forespore-specific (late) [SW|sigma factor] SigG
essential
no
synonyms
spoIIIG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,605,630 1,606,412

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]
  • Effectors of protein activity

  • [protein|01412FA454DDBA12622E3B32C433F8059123661B|CsfB] inhibits SigG activity [Pubmed|19497328]
  • the activity of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]-containing [SW|RNA polymerase] is modulated by [protein|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|YlyA] [Pubmed|23678950]
  • Structure

  • [PDB|1L0O] ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] in complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB], Geobacillus stearothermophilus, 47% identity) [pubmed|11955433]
  • Expression and Regulation

    Operons

    genes
    [gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]-[gene|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]-[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]
    description
    [Pubmed|1902213]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2512576], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1902213], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|8288522,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[SW|spoIIGA]'': expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8288522,15687200 PubMed]
  • additional information

  • the mRNA half-life is about 2.6 min [PubMed|24163345]
  • view in new tab

    genes
    [gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]
    description
    [Pubmed|1902213]

    regulation

  • ''[SW|spoIIGA]'': expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8288522,15687200 PubMed]
  • additional information

  • the mRNA half-life is about 2.6 min [PubMed|24163345]
  • a conserved hairpin in the 5' leader sequence of the [gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG] mRNA occludes the ribosome-binding site, this reduces translation by up to 4-fold [pubmed|29702640]
  • view in new tab

    Biological materials

    Mutant

  • BKE15330 ([gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTTCCCTCCCTACA, downstream forward: _UP4_TAATGAAAAGCCTTTAAAAC
  • BKK15330 ([gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTTCCCTCCCTACA, downstream forward: _UP4_TAATGAAAAGCCTTTAAAAC
  • labs

  • [SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
  • References

    Reviews

  • 20833318,31350897
  • The [SW|SigG regulon]

  • 16497325
  • Original Publications

  • 1900507,1902463,15175314,10806362,1902213,2497051,12867473,16707705,9829949,1487728,2448286,9852018,19497328,8126438,8355618,24163345,18820020,2493633,7961403,15256570,12813085,9004507,8885263,18485064,19390092,23678950,22984259,20817675,21935351,25835496,29702640,11955433