SubtiBank SubtiBank
iolR
The papers of the month are back! Check them out! Link here

iolR

transcriptional repressor of the iol operon, [SW|DeoR family]
locus
BSU39770
pI
6.33
mw
28.25 kDa
protein length
251 aa Sequence Blast
gene length
753 bp Sequence Blast
function
regulation of myo-inositol catabolism
product
transcriptional repressor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    4,084,799 → 4,085,554

    Phenotypes of a mutant

  • inactivation of ''[gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]'' reduces sporulation efficiency to 38% that of wild type cells [Pubmed|26735940]
  • The protein

    Effectors of protein activity

  • inducer: 2-deoxy-5-keto-D-gluconic acid-6-phosphate
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000051 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]-[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9226270]
  • view in new tab

    Biological materials

    Mutant

  • BKE39770 (Δ[gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAAAACTCCTTCTT, downstream forward: _UP4_TAACGTTTACAATAGTGTTG
  • BKK39770 (Δ[gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAAAACTCCTTCTT, downstream forward: _UP4_TAACGTTTACAATAGTGTTG
  • Labs working on this gene/protein

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 18310071,9226270,9887260,9887260,18310071,26735940