SubtiBank SubtiBank
acoB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

acoB

acetoin dehydrogenase E1 component (TPP-dependent beta subunit)
locus
BSU_08070
pI
4.40
mw
36.69 kDa
protein length
342 aa Sequence Blast
gene length
1029 bp Sequence Blast
function
acetoin utilization
product
acetoin dehydrogenase E1 component (TPP-dependent beta subunit)
essential
no
synonyms
yfjJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.2|Utilization of acetoin]
  • Gene

    Coordinates
    880,007 881,035

    Phenotypes of a mutant

  • defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
  • The protein

    Paralogous protein(s)

  • [protein|A024921961A786294199EA12E04456C890ED8D8C|BkdAB], [protein|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|PdhB]
  • Structure

  • [PDB|3DUF] (PDH from Geobacillus stearothermophilus, 43% identity) [pubmed|19081062]
  • [SW|Localization]

  • Membrane-proximal (Spotty) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]
    description
    [pubmed|11274109]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [PubMed|11274109], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-containing [SW|RNA polymerase]) [ PubMed|11274109], in [regulon|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR regulon]
  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: indirect positive regulation, in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]) [http://www.ncbi.nlm.nih.gov/sites/entrez/11274109 PubMed]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • MGNA-C281 (acoB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2279 NBRP B. subtilis, Japan]
  • BKE08070 ([gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTATGACTCTCGCCA, downstream forward: _UP4_GCATTGAATTAAAGGGGGGA
  • BKK08070 ([gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTATGACTCTCGCCA, downstream forward: _UP4_GCATTGAATTAAAGGGGGGA
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
  • References

  • 11274109,10368162,10666464,12884008,16479537,11274109,16428414,21815947,25875741,19081062