SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


glycine betaine and arsenobetaine [SW|ABC transporter] (permease)
30.10 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
compatible solute transport
glycine betaine and arsenobetaine [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    322,271 323,119

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glycine betaine and arsenobetaine [pubmed|29159878]
  • uptake of dimethylglycine [Pubmed|24561588]
  • Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 90-269) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453,18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23175650], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • regulation

  • induced by osmotic stress [Pubmed|23175650]
  • view in new tab

    Biological materials


  • BKE02990 ([gene|5F989C57010ACFC03E37AF5A894153F432520921|opuAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGTATTCTAGGCAGTCTAT, downstream forward: _UP4_AAGAAAAGCAGGGGGAATGC
  • BKK02990 ([gene|5F989C57010ACFC03E37AF5A894153F432520921|opuAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGTATTCTAGGCAGTCTAT, downstream forward: _UP4_AAGAAAAGCAGGGGGAATGC
  • Expression vectors

  • pGP2925 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]
  • References


  • 27935846
  • Original publications

  • 16645306,16225868,7622480,10092453,18763711,7622480,16225868,21296969,22383849,23175650,23646920,24561588,29159878