SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


52.39 kDa
protein length
475 aa Sequence Blast
gene length
1428 bp Sequence Blast
aspartate degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of asparagine/ aspartate]
  • Gene

    2,454,347 2,455,774

    The protein

    Catalyzed reaction/ biological activity

  • L-aspartate = fumarate + NH3 (according to Swiss-Prot)
  • Protein family

  • class-II fumarase/aspartase family (with [protein|A3A2EF3C95B833A11843553107D781EDEFF0BC41|CitG], according to UniProt)
  • Paralogous protein(s)

  • [protein|A3A2EF3C95B833A11843553107D781EDEFF0BC41|CitG]
  • Structure

  • [PDB|3R6Q] (from ''Bacillus'' sp. YM55-1, 72% identity, 92% similarity) [Pubmed|21661762]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1711029], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|146947C974D62BCB282BA3F5B924B35695D75886|AnsR]: repression, [Pubmed|11914346], in [regulon|146947C974D62BCB282BA3F5B924B35695D75886|AnsR regulon]
  • regulation

  • expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab



  • ''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab

    Biological materials


  • GP1153 (Δ[gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]-[gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]::''ermC'') available in [SW|Jörg Stülke]'s lab
  • BKE23570 ([gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCTTTAACCTTCTTT, downstream forward: _UP4_TAAAATTTGTATAAAATACA
  • BKK23570 ([gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCTTTAACCTTCTTT, downstream forward: _UP4_TAAAATTTGTATAAAATACA
  • lacZ fusion

  • pGP2274 (in [SW|pAC5]) (GP2961), available in [SW|Jörg Stülke]'s lab
  • References

  • 8478318,1711029,1711029,11914346,21219666,22383849