SubtiBank SubtiBank
ywcJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywcJ

similar to nitrate channel
locus
BSU_38060
pI
7.68
mw
28.31 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-48r

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.8|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.2|Anaerobic respiration]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,905,333 3,906,103

    The protein

    Protein family

  • FNT transporter (TC 2.A.44) family (with [protein|FA18A10769974D392247FB32A0891AE74DF248A0|YrhG], according to UniProt)
  • Paralogous protein(s)

  • [protein|FA18A10769974D392247FB32A0891AE74DF248A0|YrhG]
  • Structure

  • [PDB|3TDP] (from Clostridium difficile, 36% identity) [pubmed|20010838]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5FB51BA52819AEB4E6408A096B107ACB533C611A|ywcJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|16207915], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B672 (ywcJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1671 NBRP B. subtilis, Japan]
  • BKE38060 ([gene|5FB51BA52819AEB4E6408A096B107ACB533C611A|ywcJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTTTTCCTGCTTTC, downstream forward: _UP4_TAAAAAAACTTCCAGAGATC
  • BKK38060 ([gene|5FB51BA52819AEB4E6408A096B107ACB533C611A|ywcJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTTTTCCTGCTTTC, downstream forward: _UP4_TAAAAAAACTTCCAGAGATC
  • References

  • 16207915,16207915,20010838