SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


tRNA specific adenosine deaminase
17.61 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
tRNA modification
tRNA specific adenosine deaminase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    25,852 26,337

    The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the deamination of adenosine to inosine at the wobble position 34 of tRNA(Arg2) (according to UniProt)
  • adenosine34 in tRNA + H+ + H2O --> inosine34 in tRNA + NH4+ (according to UniProt)
  • Protein family

  • [SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
  • [SW|Domains]

  • [SW|CMP/dCMP-type deaminase domain] (aa 2-120) (according to UniProt)
  • Structure

  • [PDB|2B3J] (the protein of ''Staphylococcus aureus'', complex with RNA) [Pubmed|16415880]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, (both promoters), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-B891 (yaaJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00180 ([gene|5FC8D0B30B55C1CBC2CDE8E56E7E948A781EF2AB|yaaJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGATAAGCTCTCTTT, downstream forward: _UP4_TAGTACGGTTGCAATTTTTA
  • BKK00180 ([gene|5FC8D0B30B55C1CBC2CDE8E56E7E948A781EF2AB|yaaJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGATAAGCTCTCTTT, downstream forward: _UP4_TAGTACGGTTGCAATTTTTA
  • References

  • 19087206,12110595,16415880,28864459