SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative ketopantoate reductase
33.42 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
putative ketopantoate reductase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,514,052 1,514,963

    The protein

    Protein family

  • ketopantoate reductase family (with [protein|0F153803781C9AC8321FB14F926B645C45E53B00|YlbQ], according to UniProt)
  • Structure

  • [PDB|3EGO]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B353 (ykpB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14440 ([gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|ykpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTGATCTCCTTTCA, downstream forward: _UP4_TAAAAAAAGGAGGCGGAAAA
  • BKK14440 ([gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|ykpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTGATCTCCTTTCA, downstream forward: _UP4_TAAAAAAAGGAGGCGGAAAA