SubtiBank SubtiBank
bshB1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bshB1

N-acetylglucosamine-malate deacetylase, involved in bacillithiol synthesis (major enzyme)
locus
BSU_22470
pI
6.34
mw
24.66 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
function
biosynthesis of bacillithiol
product
N-acetylglucosamine-malate deacetylase
essential
no
synonyms
jojG,ypjG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.2|Biosynthesis of bacillithiol]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,358,208 2,358,918

    The protein

    Catalyzed reaction/ biological activity

  • GlcNAc-Mal GlcN-Mal + Ac
  • (S)-malyl N-acetyl-α-D-glucosaminide + H2O --> (S)-malyl α-D-glucosaminide + acetate (accrding to UniProt)
  • Protein family

  • PIGL family (with [protein|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|BshB2], according to UniProt)
  • Paralogous protein(s)

  • [protein|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|BshB2]
  • Structure

  • [PDB|2IXD] (from B. cereus, 62% identity) [pubmed|17501983]
  • Expression and Regulation

    Operons

    genes
    [gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]-[gene|5AB90032031653A913E15B26B3E1AE246E95AABF|dapB]-[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]-[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]-[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]-[gene|4C4FA59FF5D100E941EF470C0C54E85681ADC74F|cca]-[gene|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A409 (ypjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/409 NBRP B. subtilis, Japan]
  • ''bshB1'' null mutant and ''[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]'' / ''[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]'' double null mutant available in [SW|John Helmann] lab
  • GP87 (''ypjG''::''pX2''(''cat'')), available in [SW|Jörg Stülke]'s lab
  • BKE22470 ([gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGCCAAAAGCAAGAACGT, downstream forward: _UP4_CTTGATCATGATGTGCTTGG
  • BKK22470 ([gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGCCAAAAGCAAGAACGT, downstream forward: _UP4_CTTGATCATGATGTGCTTGG
  • References

    Reviews

  • 28117687
  • Original Publications

  • 20308541,19578333,23894131,23758290,25988368,17501983