SubtiBank SubtiBank
bshB1
The papers of the month are back! Check them out! Link here

bshB1

N-acetylglucosamin-malate deacetylase, involved in bacillithiol synthesis (major enzyme)
locus
BSU22470
pI
6.34
mw
24.66 kDa
protein length
224 aa Sequence Blast
gene length
672 bp Sequence Blast
function
biosynthesis of bacillithiol
product
N-acetylglucosamin-malate deacetylase
essential
no
synonyms
jojG,ypjG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.2|Biosynthesis of bacillithiol]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,358,208 → 2,358,918

    The protein

    Catalyzed reaction/ biological activity

  • GlcNAc-Mal → GlcN-Mal + Ac
  • Paralogous protein(s)

  • [protein|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|BshB2]
  • Structure

  • [PDB|2IXD] (from B. cereus, 62% identity) [pubmed|17501983]
  • Expression and Regulation

    Operons

    genes
    [gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]-[gene|5AB90032031653A913E15B26B3E1AE246E95AABF|dapB]-[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]-[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]-[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]-[gene|4C4FA59FF5D100E941EF470C0C54E85681ADC74F|cca]-[gene|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A409 (ypjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/409 NBRP B. subtilis, Japan]
  • ''bshB1'' null mutant and ''[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]'' / ''[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]'' double null mutant available in [SW|John Helmann] lab
  • GP87 (''ypjG''::''pX2''(''cat'')), available in [SW|Stülke] lab
  • BKE22470 (Δ[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGCCAAAAGCAAGAACGT, downstream forward: _UP4_CTTGATCATGATGTGCTTGG
  • BKK22470 (Δ[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGCCAAAAGCAAGAACGT, downstream forward: _UP4_CTTGATCATGATGTGCTTGG
  • References

    Reviews

  • 28117687
  • Original Publications

  • 20308541,19578333,23894131,23758290,25988368,17501983