SubtiBank SubtiBank
pdaC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pdaC

peptidoglycan deacetylase C, confers lysozyme resistance to modified cell wall peptidoglycans
locus
BSU_12100
pI
9.10
mw
53.67 kDa
protein length
467 aa Sequence Blast
gene length
1404 bp Sequence Blast
function
cell wall modification
product
polysaccharide deacetylase C
essential
no
synonyms
yjeA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,281,128 1,282,531

    Phenotypes of a mutant

  • sensitive to lysozyme treatment [Pubmed|22277649]
  • The protein

    Catalyzed reaction/ biological activity

  • deacetylates N-acetylmuramic acid (MurNAc) but not GlcNAc from peptidoglycan [Pubmed|22277649]
  • Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2E2D21BEA164C7EB93B6A3F3C990ABD475920A81|YheN]:
  • [SW|Domains]

  • aa 55 - 140: DUF4163
  • aa 155 - 235: DUF3298
  • [SW|NodB homology domain] (aa 278-452) (according to UniProt)
  • Structure

  • [PDB|6H8L] (the C-terminal family 4 carbohydrate esterase (CE4) catalytic domain) [pubmed|31690626]
  • [PDB|2C1G] (the NodB domain, from Streptococcus pneumoniae, 47% identity) [pubmed|16221761]
  • [PDB|3S5T] (the DUF3298 domain, from Bacteroides fragilis, 27% identity)
  • [SW|Localization]

  • cell membrane (single pass) [pubmed|31690626]
  • Expression and Regulation

    Operons

    genes
    [gene|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: repression, in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-A355 (yjeA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/355 NBRP B. subtilis, Japan]
  • BKE12100 ([gene|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACTCCTTCTTTC, downstream forward: _UP4_TAAATTAGAAAAGGCTGTCC
  • BKK12100 ([gene|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACTCCTTCTTTC, downstream forward: _UP4_TAAATTAGAAAAGGCTGTCC
  • References

  • 17878218,17581128,22277649,23199363,26883633,16221761,29465029,31690626