SubtiBank SubtiBank
rodZ
The papers of the month are back! Check them out! Link here

rodZ

required for proper septum positioning during vegetative growth (cell shape determination)
locus
BSU16910
pI
4.68
mw
23.48 kDa
protein length
213 aa Sequence Blast
gene length
639 bp Sequence Blast
function
septum positioning during vegetative growth
product
morphogenic protein
essential
yes
synonyms
ymfM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,761,707 → 1,762,573

    Phenotypes of a mutant

  • essential [Pubmed|19164570,23879732]
  • depletion results in the formation of shorter and rounder cells [Pubmed|23879732]
  • depletion results in disturbed formation of asymmetric septa and perturbed [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation [Pubmed|27415800]
  • hypersensitivity to sorbic acid stress [Pubmed|27818647]
  • small, round, DNA-containing cells [pubmed|29403445]
  • The protein

    [SW|Domains]

  • N-terminal cytoplasmic domain (RodZn), a transmembrane domain, and C-terminal extra-cytoplasmic domain (RodZc) [Pubmed|25503291]
  • [SW|Localization]

  • membrane protein (according to Swiss Prot)
  • Additional information

  • overexpression results in growth inhibition in minimal medium (in the absence of Mg2+ ) [Pubmed|19164570]
  • RodZ is destabilized in a ''[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB]'' mutant [Pubmed|23879732]
  • Biological materials

    Mutant

  • MGNA-B120 (ymfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1119 NBRP B. subtilis, Japan]
  • BKE16910 (Δ[gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC
  • BKK16910 (Δ[gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC
  • Labs working on this gene/protein

  • [SW|Adriano Henriques], Lisbon, Portugal [http://www.itqb.unl.pt/research/biology/microbial-development homepage]
  • References

  • 19164570,21636744,21636745,23879732,25503291,27415800,27818647,29403445