SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


required for proper septum positioning during vegetative growth ([SW|cell shape] determination), part of the [protein|search|Rod complex] for lateral [SW|cell wall synthesis] and control of cell diameter
23.48 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
septum positioning during vegetative growth
morphogenic protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,761,707 1,762,573

    Phenotypes of a mutant

  • essential [Pubmed|19164570,23879732]
  • depletion results in the formation of shorter and rounder cells [Pubmed|23879732]
  • depletion results in disturbed formation of asymmetric septa and perturbed [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation [Pubmed|27415800]
  • hypersensitivity to sorbic acid stress [Pubmed|27818647]
  • small, round, DNA-containing cells [pubmed|29403445]
  • The protein


  • N-terminal cytoplasmic domain (RodZn), a transmembrane domain, and C-terminal extra-cytoplasmic domain (RodZc) [Pubmed|25503291]
  • Structure

  • [PDB|3FYM] (from Staphylococcus aureus, corresponds to aa 1 ... 112, 31% identity)
  • [SW|Localization]

  • membrane protein (according to UniProt)
  • Additional information

  • overexpression results in growth inhibition in minimal medium (in the absence of Mg2+ ) [Pubmed|19164570]
  • RodZ is destabilized in a ''[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB]'' mutant [Pubmed|23879732]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B120 (ymfM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16910 ([gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC
  • BKK16910 ([gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC
  • labs

  • [SW|Adriano Henriques], Lisbon, Portugal [ homepage]
  • References

  • 19164570,21636744,21636745,23879732,25503291,27415800,27818647,29403445,30651563,31086310