SubtiBank SubtiBank
fabI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fabI

enoyl-acyl carrier protein reductase
locus
BSU_11720
pI
5.61
mw
27.72 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
function
fatty acid biosynthesis
product
enoyl-acyl carrier protein reductase
essential
no
ec
1.3.1.9
synonyms
yjbW

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.1|Biosynthesis of fatty acids]
  • Gene

    Coordinates
    1,247,788 1,248,564

    The protein

    Catalyzed reaction/ biological activity

  • Acyl-[acyl-carrier-protein] NAD = trans-2,3-dehydroacyl-[acyl-carrier-protein] NADH (according to Swiss-Prot)
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5964B6E817260DA7937796DDFA753A665A04D650|FabL]:
  • Effectors of protein activity

  • inhibited by triclosan [Pubmed|11325930]
  • Structure

  • [PDB|3OIF] (complex with NAD and inhibitor triclosan) [Pubmed|21185310]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|60A519E4C1485B9F5BF36E83EDE884B396857CB4|fabI]
    description
    [Pubmed|12737802]

    sigma factors

  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [pubmed|29914988], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]: repression, [Pubmed|12737802], in [regulon|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR regulon]
  • regulation

  • expressed when the cells experience a lack of malonyl-CoA ([protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]) [Pubmed|12737802]
  • expression of the operon is strongly reduced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B168 (yjbW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1167 NBRP B. subtilis, Japan]
  • BKE11720 ([gene|60A519E4C1485B9F5BF36E83EDE884B396857CB4|fabI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTATAAAGCCTCCTA, downstream forward: _UP4_TAAGCAGGATCTATATCAAG
  • BKK11720 ([gene|60A519E4C1485B9F5BF36E83EDE884B396857CB4|fabI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTATAAAGCCTCCTA, downstream forward: _UP4_TAAGCAGGATCTATATCAAG
  • References

    Reviews

  • 15952903,17919287
  • Original Publications

  • 12737802,17114254,8953047,11007778,21185310,21383089,15378759,29914988,31113899