SubtiBank SubtiBank
comX
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

comX

competence pheromone precursor, transfers cell density signal to ComP; triggers the production of surfactin
locus
BSU31700
pI
4.36
mw
6.38 kDa
protein length
gene length
165 bp Sequence Blast
function
quorum sensing
product
competence pheromone precursor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    3,255,853 → 3,256,020

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein

    Modification

  • is synthesized as an inactive precursor, cleaved, and modified (prenylated) on W53 by [protein|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|ComQ] prior to excretion [Pubmed|28326143,22878193]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]-[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]
    description
    [Pubmed|1715859]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1715859], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • induced under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|25666134]
  • view in new tab

    Biological materials

    Mutant

  • BKE31700 (Δ[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTAGGTCTTGCATCTTGT, downstream forward: _UP4_GGTGATTAATAGGTGGATTA
  • BKK31700 (Δ[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTAGGTCTTGCATCTTGT, downstream forward: _UP4_GGTGATTAATAGGTGGATTA
  • References

    Reviews

  • 22024380,28326143
  • Original publications

  • 16407988,11133937,12067344,19202088,14679219,15564679,17240141,19605685,1715859,22878193,24296669,22511326,21636272,24425772,24788106,25757097,26276536,26787913,26927849,29038467