SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


competence pheromone precursor, transfers cell density signal to [protein|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|ComP]; triggers the production of surfactin
6.38 kDa
protein length
gene length
165 bp Sequence Blast
[category|SW 3.4.8|Quorum sensing]
competence pheromone precursor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    3,255,853 → 3,256,020

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein


  • is synthesized as an inactive precursor, cleaved, and modified (prenylated) on W53 by [protein|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|ComQ] prior to excretion [Pubmed|28326143,22878193]
  • ComX is degraded by [protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|subtilisin] [pubmed|29449835]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1715859], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • induced under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|25666134]
  • view in new tab

    Biological materials


  • BKE31700 (Δ[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTAGGTCTTGCATCTTGT, downstream forward: _UP4_GGTGATTAATAGGTGGATTA
  • BKK31700 (Δ[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTAGGTCTTGCATCTTGT, downstream forward: _UP4_GGTGATTAATAGGTGGATTA
  • References


  • 22024380,28326143
  • Original publications

  • 16407988,11133937,12067344,19202088,14679219,15564679,17240141,19605685,1715859,22878193,24296669,22511326,21636272,24425772,24788106,25757097,26276536,26787913,26927849,29038467,29449835