SubtiBank SubtiBank
ptkA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ptkA

protein tyrosine kinase
locus
BSU_36250
pI
9.63
mw
25.64 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
function
protein phosphorylation
product
protein tyrosine kinase
essential
no
synonyms
ywqD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    3,731,822 3,732,535

    Phenotypes of a mutant

  • Accumulation of extra chromosome equivalents [Pubmed|17367396]
  • Defect in [SW|biofilm formation], this involves the kinase activity, but the target protein is unknown [Pubmed|20815827]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + L-tyrosyl-[protein] --> ADP + H+ + O-phospho-L-tyrosyl-[protein] (according to UniProt)
  • autophosphorylation, phosphorylation of [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|Ugd], [protein|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|TuaD], [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB], [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB]
  • Protein family

  • BY-kinase, see the [http://bykdb.ibcp.fr/BYKdb/BYKdbHelp Bacterial Protein Tyrosine Kinase Database]
  • CpsD/CapB family (with [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB], according to UniProt)
  • Paralogous protein(s)

  • [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB]
  • [SW|Domains]

  • single BY-kinase domain
  • Modification

  • autophosphorylation at residues Y225, Y227 and Y228 (primary site) [Pubmed|20509597], dephosphorylated by [protein|CF73D86DB024575BE8F043A4C3996458F4262E46|PtpZ] [Pubmed|15866923]
  • [SW|Cofactors]

  • ATP
  • Effectors of protein activity

  • [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA] - transmembrane modulator, activates PtkA autophosphorylation and substrate phosphorylation [Pubmed|12970183]
  • the mutually exclusive interactions of PtsA with the modulator proteins [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA], [protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA], and probably [protein|37DAD42A391E2FC506225EAF91B8F21629A401DF|MinD] direct the kinase to different substrates [Pubmed|27725816]
  • Structure

  • [PDB|2VED] (CapB, the homolog in ''Staphylococcus aureus'')
  • Expression and Regulation

    Operons

    genes
    [gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]-[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]
    description
    [Pubmed|20815827,12970183]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20815827], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|26283769], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|26283769], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A078 (ywqD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/78 NBRP B. subtilis, Japan]
  • KO strain created with pMUTIN-2, available from [SW|Ivan Mijakovic]
  • GP1520 (spc), available in [SW|Jörg Stülke]'s lab
  • GP1544 (ermC), available in [SW|Jörg Stülke]'s lab
  • GP1587 (cat) , available in [SW|Jörg Stülke]'s lab
  • GP1521 ''[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'' (aphA3) ''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]'' (spc) double mutant available in [SW|Jörg Stülke]'s lab
  • GP1529 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]''::spc available in [SW|Jörg Stülke]'s lab
  • GP1610 (''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]'', spc), available in [SW|Jörg Stülke]'s lab
  • BKE36250 ([gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT, downstream forward: _UP4_TAAATAACGTGCATCGTGCC
  • BKK36250 ([gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT, downstream forward: _UP4_TAAATAACGTGCATCGTGCC
  • Expression vectors

  • pQE-30, N-terminally 6xHis-tagged, available from [SW|Ivan Mijakovic]
  • lacZ fusion

  • in a KO strain created with pMUTIN-2, available from [SW|Ivan Mijakovic]
  • GFP fusion

  • CFP-fusion, available from [SW|Ivan Mijakovic]
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Ivan Mijakovic], Thiverval-Grignon, France
  • References

    Reviews

  • 20497498,24554699,25540643,25667587,26286503
  • Original publications

  • 12970183,15741737,15866923,17367396,19258708,18547145,20497499,20509597,20815827,20817675,23939619,24493247,24728941,25278935,25374563,26283769,26094643,27148221,27725816