SubtiBank SubtiBank
nusB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nusB

transcription antitermination factor
locus
BSU_24320
pI
4.76
mw
14.74 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
stable RNA transcription
product
antitermination factor
essential
no
synonyms
yqhZ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.3|Transcription elongation/ termination]
  • Gene

    Coordinates
    2,529,267 2,529,662

    The protein

    Protein family

  • nusB family (single member, according to UniProt)
  • Structure

  • [PDB|1EYV] (from Mycobacterium tuberculosis, 40% identity) [pubmed|10881194]
  • [PDB|3R2C] (the [protein|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|NusB]-[protein|751D0B909922D4D931FF3B2285CF142D966FCD48|RpsJ] complex from Aquifex aeolicus) [pubmed|21652641]
  • Expression and Regulation

    Operons

    genes
    [gene|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|nusB]-[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]
    description
    [Pubmed|2536750,11591660]

    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750,11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • repressed in the presence of purine nucleotides ([protein|search|PurR]) [Pubmed|2536750,11591660]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C368 (yqhZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2366 NBRP B. subtilis, Japan]
  • BKE24320 ([gene|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|nusB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCTCCTTTGAT, downstream forward: _UP4_TAGGAGGAAAGAAAATGACT
  • BKK24320 ([gene|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|nusB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCTCCTTTGAT, downstream forward: _UP4_TAGGAGGAAAGAAAATGACT
  • References

  • 11948165,16707701,11591660,2536750,10881194,21652641,30023707