SubtiBank SubtiBank
rocD

rocD

ornithine transaminase
locus
BSU_40340
pI
4.89
mw
43.60 kDa
protein length
401 aa Sequence Blast
gene length
1203 bp Sequence Blast
function
arginine, ornithine and citrulline utilization
product
ornithine transaminase
essential
no
ec
2.6.1.13
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • Gene

    Coordinates
    4,144,301 → 4,145,506

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxocarboxylate + L-ornithine --> L-α-amino acid + L-glutamate 5-semialdehyde (according to UniProt)
  • Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3RUY] (from ''B. anthracis'', 76% identity, 93% similarity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocD]-[gene|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE]-[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]
    description
    [Pubmed|7540694]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|7540694], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7540694], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|7540694], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • regulation

  • induced by arginine ([protein|search|RocR], [protein|search|AhrC]) [Pubmed|7540694]
  • additional information

  • expression of the ''[protein|search|rocD]-[protein|search|rocE]-[protein|search|rocF]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • GP656, aphA3, available in [SW|Jörg Stülke]'s lab
  • BKE40340 (Δ[gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGAATTCCCCCTTG, downstream forward: _UP4_TAAATCCGCACCATGGCGGG
  • BKK40340 (Δ[gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGAATTCCCCCTTG, downstream forward: _UP4_TAAATCCGCACCATGGCGGG
  • References

  • 12618455,23869754,14651647,12618455,7540694