SubtiBank SubtiBank
narH

narH

nitrate reductase (beta subunit)
locus
BSU_37270
pI
5.11
mw
55.30 kDa
protein length
487 aa Sequence Blast
gene length
1464 bp Sequence Blast
function
nitrate respiration, nitrogen assimilation
product
nitrate reductase (beta subunit)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.2|Anaerobic respiration]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,824,806 3,826,269

    The protein

    Catalyzed reaction/ biological activity

  • quinol + nitrate --> quinone + H2O + nitrite (according to UniProt)
  • [SW|Domains]

  • 3 [SW|4Fe-4S ferredoxin-type domain]s (aa 7-36, aa 172-203, aa 205-234) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [Pubmed|11289299]
  • Structure

  • [PDB|1Q16] (the [protein|B992698A12EE9D17DCEF075F82396D5456D35A20|NarG]-[protein|6181C785427277C097B81D67A93213AEAF701FF4|NarH]-[protein|20060F4C1939FB9A10CB279745D75D0A16627EC6|NarI] complex of E. coli, 59% identity) [pubmed|12910261]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B992698A12EE9D17DCEF075F82396D5456D35A20|narG]-[gene|6181C785427277C097B81D67A93213AEAF701FF4|narH]-[gene|5528AD62C1BF608D181C8960C88620B63B1E60A0|narJ]-[gene|20060F4C1939FB9A10CB279745D75D0A16627EC6|narI]
    description
    [Pubmed|8846791,16428414]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8846791,16428414], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: activation, [Pubmed|8846791,16428414], in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|Fnr]) [Pubmed|8846791,16428414]
  • view in new tab

    Biological materials

    Mutant

  • BKE37270 ([gene|6181C785427277C097B81D67A93213AEAF701FF4|narH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATGACCATACCGATTT, downstream forward: _UP4_TAACTTTTGATAAATGAGGT
  • BKK37270 ([gene|6181C785427277C097B81D67A93213AEAF701FF4|narH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATGACCATACCGATTT, downstream forward: _UP4_TAACTTTTGATAAATGAGGT
  • References

    Reviews

  • 11289299
  • Original publications

  • 9352926,8846791,16428414,12910261