SubtiBank SubtiBank
ymaF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymaF

unknown
locus
BSU_17320
pI
6.36
mw
15.49 kDa
protein length
137 aa Sequence Blast
gene length
414 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,865,876 1,866,289

    The protein

    [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|61B511C49912F1380AEE18AD300255A435F56F94|ymaF]-[gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]-[gene|40D3FE1A512703B090316C31099956DB6A7F515B|hfq]
    description
    [pubmed|22383849]

    regulation

  • expressed during [SW|sporulation ][Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE17320 ([gene|61B511C49912F1380AEE18AD300255A435F56F94|ymaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCCTCCTTTTCCTCGA, downstream forward: _UP4_TAGAAGGATGTTTACCGATG
  • BKK17320 ([gene|61B511C49912F1380AEE18AD300255A435F56F94|ymaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCCTCCTTTTCCTCGA, downstream forward: _UP4_TAGAAGGATGTTTACCGATG
  • References

  • 16479537,12060778,27766092