SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


75.77 kDa
protein length
677 aa Sequence Blast
gene length
2034 bp Sequence Blast
degradation of levan to fructose

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,758,043 2,760,076

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal, non-reducing (2->1)- and (2->6)-linked beta-D-fructofuranose residues in fructans (according to UniProt)
  • Protein family

  • glycosyl hydrolase 32 family (with [protein|33BEC05F2129EBAF6699E847B0909A5A48F0E869|LevB] and [protein|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|SacA], according to UniProt)
  • [SW|Domains]

  • glycosyl hydrolase 32 family domain, aa 30 - 513 [pubmed|23213210]
  • C-terminal carbohydrate-binding module, aa 515-677 [pubmed|23213210]
  • Structure

  • [PDB|1Y9M] (inulinase of Aspergillus awamori, glycosyl hydrolase 32 family domain, aa 30 - 513, 42% identity) [pubmed|15522299]
  • [PDB|4B1M] (the C-terminal carbohydrate-binding module, aa 515-677) [pubmed|23213210]
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|1924373], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7592486], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR]: activation, [Pubmed|1900939], in [regulon|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR regulon]
  • regulation

  • induced in the presence of fructose ([protein|search|LevR]) [Pubmed|1900939]
  • view in new tab

    Biological materials


  • BKE27030 ([gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTCCTTCGCTCCTC, downstream forward: _UP4_TAATTTTAAAAAAGGCACAG
  • BKK27030 ([gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTCCTTCGCTCCTC, downstream forward: _UP4_TAATTTTAAAAAAGGCACAG
  • References


  • 20735481,1784813
  • Research papers

  • 15522299,23213210,1900939,2117666,7592486