SubtiBank SubtiBank
sacC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sacC

levanase
locus
BSU_27030
pI
6.79
mw
75.77 kDa
protein length
677 aa Sequence Blast
gene length
2034 bp Sequence Blast
function
degradation of levan to fructose
product
levanase
essential
no
ec
3.2.1.80
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,758,043 2,760,076

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal, non-reducing (2->1)- and (2->6)-linked beta-D-fructofuranose residues in fructans (according to UniProt)
  • Protein family

  • glycosyl hydrolase 32 family (with [protein|33BEC05F2129EBAF6699E847B0909A5A48F0E869|LevB] and [protein|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|SacA], according to UniProt)
  • [SW|Domains]

  • glycosyl hydrolase 32 family domain, aa 30 - 513 [pubmed|23213210]
  • C-terminal carbohydrate-binding module, aa 515-677 [pubmed|23213210]
  • Structure

  • [PDB|1Y9M] (inulinase of Aspergillus awamori, glycosyl hydrolase 32 family domain, aa 30 - 513, 42% identity) [pubmed|15522299]
  • [PDB|4B1M] (the C-terminal carbohydrate-binding module, aa 515-677) [pubmed|23213210]
  • Expression and Regulation

    Operons

    genes
    [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]
    description
    [Pubmed|2117666]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|1924373], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7592486], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR]: activation, [Pubmed|1900939], in [regulon|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR regulon]
  • regulation

  • induced in the presence of fructose ([protein|search|LevR]) [Pubmed|1900939]
  • view in new tab

    Biological materials

    Mutant

  • BKE27030 ([gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTCCTTCGCTCCTC, downstream forward: _UP4_TAATTTTAAAAAAGGCACAG
  • BKK27030 ([gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTCCTTCGCTCCTC, downstream forward: _UP4_TAATTTTAAAAAAGGCACAG
  • References

    Reviews

  • 20735481,1784813
  • Research papers

  • 15522299,23213210,1900939,2117666,7592486