SubtiBank SubtiBank
yhjP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhjP

similar to [SW|ABC transporter] (peptide binding protein)
locus
BSU_10590
pI
6.12
mw
66.20 kDa
protein length
575 aa Sequence Blast
gene length
1728 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,133,498 1,135,225

    The protein

    Protein family

  • C-terminal part: [SW|bacterial solute-binding protein 5 family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 1-120) (according to UniProt)
  • Structure

  • [PDB|6TFX] (from Agrobacterium tumefaciens, corresponds to aa 130 ... 564, 23% identity) [pubmed|31922182]
  • Biological materials

    Mutant

  • MGNA-A728 (yhjP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/728 NBRP B. subtilis, Japan]
  • BKE10590 ([gene|61D74BCF9E52A007C596A2C783496EF823FDC2F0|yhjP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCCCGCACCTCCCGAC, downstream forward: _UP4_TAAAAAGAGGGTTCTTTTTT
  • BKK10590 ([gene|61D74BCF9E52A007C596A2C783496EF823FDC2F0|yhjP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCCCGCACCTCCCGAC, downstream forward: _UP4_TAAAAAGAGGGTTCTTTTTT
  • References

    Research papers

  • 31922182