SubtiBank SubtiBank
rpsNB
The papers of the month are back! Check them out! Link here

rpsNB

alternative ribosomal protein S14*, can replace RpsN under conditions of zinc limitation
locus
BSU08880
pI
11.19
mw
10.20 kDa
protein length
gene length
267 bp Sequence Blast
function
translation
product
alternative ribosomal protein S14*
essential
no
synonyms
rpsNB,yhzA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    965,909 → 966,178

    The protein

    Paralogous protein(s)

  • [protein|0CC562884650F322298BEA28C889E2ABCB01AFDE|RpsN]
  • Expression and Regulation

    Operons

    genes
    [gene|6212D2DB719ACC477DA835EAC198545318FFEFAC|rpsNB]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [PubMed|12904577,17163968], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]) [PubMed|12904577,17163968]
  • part of the third wave of induction upon zinc depletion [Pubmed|27561249]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE08880 (Δ[gene|6212D2DB719ACC477DA835EAC198545318FFEFAC|rpsNB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCACATAGCCTCCCTT, downstream forward: _UP4_TGGTAAGAAAAAACTCCGGC
  • BKK08880 (Δ[gene|6212D2DB719ACC477DA835EAC198545318FFEFAC|rpsNB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCACATAGCCTCCCTT, downstream forward: _UP4_TGGTAAGAAAAAACTCCGGC
  • References

  • 17163968,12884008,12904577,20208344,12904577,17163968,19648245,23002217,27561249