SubtiBank SubtiBank
rpsNB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rpsNB

alternative ribosomal protein S14*, can replace [protein|0CC562884650F322298BEA28C889E2ABCB01AFDE|RpsN] under conditions of zinc limitation
locus
BSU_08880
pI
11.19
mw
10.20 kDa
protein length
gene length
270 bp Sequence Blast
function
translation
product
alternative ribosomal protein S14*
essential
no
synonyms
rpsNB,yhzA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    965,909 966,178

    The protein

    Protein family

  • universal [SW|ribosomal protein] uS14 family (with [protein|0CC562884650F322298BEA28C889E2ABCB01AFDE|RpsN], according to UniProt)
  • Paralogous protein(s)

  • [protein|0CC562884650F322298BEA28C889E2ABCB01AFDE|RpsN]
  • Structure

  • [PDB|5AFI] (the E. coli ribosome, 47% identity) [pubmed|25707802]
  • Expression and Regulation

    Operons

    genes
    [gene|6212D2DB719ACC477DA835EAC198545318FFEFAC|rpsNB]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [PubMed|12904577,17163968], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]) [PubMed|12904577,17163968]
  • part of the third wave of induction upon zinc depletion [Pubmed|27561249]
  • expression requires functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE08880 ([gene|6212D2DB719ACC477DA835EAC198545318FFEFAC|rpsNB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCACATAGCCTCCCTT, downstream forward: _UP4_TGGTAAGAAAAAACTCCGGC
  • BKK08880 ([gene|6212D2DB719ACC477DA835EAC198545318FFEFAC|rpsNB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCACATAGCCTCCCTT, downstream forward: _UP4_TGGTAAGAAAAAACTCCGGC
  • References

  • 17163968,12884008,12904577,20208344,12904577,17163968,19648245,23002217,27561249,25707802