SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|stressosome] sensor protein, control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
30.90 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
activator of [protein|search|RsbT ]kinase activity, [SW|stressosome] sensor protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    519,408 520,232

    The protein

    Catalyzed reaction/ biological activity

  • positive regulator of [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]-dependent light activation of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] stress response [Pubmed|22287516]
  • phosphorylated [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] activates the kinase activity of [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|23320651]
  • Paralogous protein(s)

  • [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB], [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|RsbRC]
  • [SW|Domains]

  • RsbRA is composed of an N-terminal nonheme globin domain and a highly conserved C-terminal STAS (Sulphate Transporter and AntiSigma factor antagonist) domain. The C-terminal STAS domain is the target of the serine/threonine-specific kinase [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] (see below).
  • [SW|STAS domain] (aa 150-265) (according to UniProt)
  • Modification

  • phosphorylation on Thr-171 and Thr-205 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|21362065]
  • Structure

  • [PDB|2BNL] (N-terminal domain), [PDB|3VY9] (complete stressosome)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE04670 ([gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTCGCTTACCTCCCAA, downstream forward: _UP4_ATCGTTTCATTGGGGGAATA
  • BKK04670 ([gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTCGCTTACCTCCCAA, downstream forward: _UP4_ATCGTTTCATTGGGGGAATA
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [ homepage]
  • [SW|Rick Lewis], Newcastle, UK [ homepage]
  • References


  • 19704888,16319496,20658979,23416074,28271471
  • Original publications

  • 8002610,8682769,8682789,17726680,10781545,15583165,8824586,10329124,17158665,9179850,8808936,15312768,11244072,15342582,15378759,12950928,15466036,9179850,8955331,18832644,17726680,17218307,20019076,21602359,23320651,21362065,20935101,22287516,22609918,24599254,28727759