SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative Fe-S oxidoreductase, affects the level of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
43.00 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
control of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
putative Fe-S oxidoreductase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    868,007 869,128

    Phenotypes of a mutant

  • inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
  • The protein

    Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C348 (yfkA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07955 ([gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTATCTAACTCCTTT, downstream forward: _UP4_TAGATGCGGATGAAAGAAAC
  • BKK07955 ([gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTATCTAACTCCTTT, downstream forward: _UP4_TAGATGCGGATGAAAGAAAC
  • References

  • 22383849,29615499