SubtiBank SubtiBank
yoaE

yoaE

formate dehydrogenase
locus
BSU_18570
pI
7.33
mw
76.06 kDa
protein length
680 aa Sequence Blast
gene length
2043 bp Sequence Blast
function
unknown
product
formate dehydrogenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    Coordinates
    2,025,400 2,027,442

    The protein

    Protein family

  • [SW|prokaryotic molybdopterin-containing oxidoreductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|FEE1952DFA3D6A5E2DC108B3B203B526642E2C68|YyaE]
  • [SW|Domains]

  • [SW|4Fe-4S Mo/W bis-MGD-type domain] (aa 9-66) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|2VPW] (from Thermus thermophilus, 25% identity) [pubmed|18536726]
  • Expression and Regulation

    Operons

    genes
    [gene|628CCADB3C9A5F8A128C44ADE1DFDC2FC6B3CD01|yoaE]-[gene|78B66D5B9848D8247D8B9A0DE8923F50F8FCDB46|yoaF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A836 (yoaE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/836 NBRP B. subtilis, Japan]
  • BKE18570 ([gene|628CCADB3C9A5F8A128C44ADE1DFDC2FC6B3CD01|yoaE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCCCAGTTCCTCTCTC, downstream forward: _UP4_TGAAAAATAATGAAACCCGG
  • BKK18570 ([gene|628CCADB3C9A5F8A128C44ADE1DFDC2FC6B3CD01|yoaE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCCCAGTTCCTCTCTC, downstream forward: _UP4_TGAAAAATAATGAAACCCGG
  • References

    Research papers

  • 18536726