SubtiBank SubtiBank
alaT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

alaT

PLP-dependent L-alanine aminotransferase
locus
BSU_31400
pI
5.11
mw
42.15 kDa
protein length
386 aa Sequence Blast
gene length
1161 bp Sequence Blast
function
biosynthesis of L-alanine
product
PLP-dependent L-alanine aminotransferase
essential
no
synonyms
yugH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.15|Biosynthesis/acquisition of L- and D-alanine]
  • Gene

    Coordinates
    3,225,772 3,226,932

    The protein

    Catalyzed reaction/ biological activity

  • pyruvate + glutamate --> L-alanine + 2-oxoglutarate [https://www.biorxiv.org/content/10.1101/562850v2 reference]
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|AspB], [protein|094AE3AC8DFAFC8048ADAAB34F76DF2562D80CE7|PatA]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1DJU] (from ''Pyrococcus horikoshii'', 47% identity) [Pubmed|10671523]
  • Additional information

  • The gene is annotated in KEGG as an ortholog of N-succinyldiaminopimelate aminotransferase EC 2.6.1.17. It is annotated in Swiss-Prot as alanine transaminase. In MetaCyc the gene is marked as similar to aspartate
  • aminotransferase. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]-[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]
    description
    [Pubmed|22383849]

    additional information

  • A [protein|search|ncRNA] is predicted between [gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI] and [gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A621 (yugH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/621 NBRP B. subtilis, Japan]
  • BKE31400 ([gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATAGTCTGATAAATACGAAG, downstream forward: _UP4_TAAAAAAAGATACGAACCTT
  • BKK31400 ([gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATAGTCTGATAAATACGAAG, downstream forward: _UP4_TAAAAAAAGATACGAACCTT
  • References

  • 20525796,22383849,10671523