SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional regulator of the ArgR family, AhrC represses the genes for arginine biosynthesis and activates the genes for arginine catabolism
16.69 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
transcriptional regulator of arginine metabolic genes
transcriptional regulator (ArgR family)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,522,324 2,522,773

    Phenotypes of a mutant

  • increased intracellular concentration of ornithine, citrulline, and arginine [pubmed|28679749]
  • [gene|search|ahrC ]inactivation allows growth of a [gene|search|ktrA ][gene|search|ktrB ][gene|search|kimA ]mutant at low potassium concentration [pubmed|28679749]
  • The protein

    Catalyzed reaction/ biological activity

  • transcriptional activator/ repressor of genes involved in arginine metabolism
  • Protein family

  • ArgR family (single member, according to UniProt)
  • [SW|Cofactors]

  • L-arginine is the co-factor required for transcription repression/ activation
  • Structure

  • [PDB|2P5L] (complex with an 18bp DNA operator) [pubmed|18455186]
  • [PDB|2P5K] (N-terminus) [pubmed|18007039]
  • [PDB|2P5M] (C-Terminus) [pubmed|18007040]
  • [PDB|1F9N] [pubmed|11856827]
  • [SW|Localization]

  • Cytoplasm
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation




  • by [protein|search|sRNA] [protein|search|sr1]
  • additional information

  • expression is fourfold increased upon depletion of ''[SW|nusA]'' [ Reference]
  • view in new tab


    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Other regulations

  • [protein|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|Sr1]: translation inhibition,
  • additional information

  • the [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA controls [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] expression via binding to the [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA, binding is enhanced by [gene|93F328524989597C7D2329B25E665496C9631E87|csrA] [pubmed|31043113]
  • Biological materials


  • GP729 (''Δ''''[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP3122 (''Δ''''[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • GP2185 (''Δ''''[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]''::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
  • BKE24250 ([gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGCACCTCTATTTC, downstream forward: _UP4_TAACAGAAAATCTAACAAAG
  • BKK24250 ([gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGCACCTCTATTTC, downstream forward: _UP4_TAACAGAAAATCTAACAAAG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Simon Phillips], Leeds University, UK [ Homepage]
  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [ Homepage]
  • References

  • 17020585,17576690,18455186,18007040,18007039,11856827,11305941,9383188,7565595,1312212,2106508,27171430,28679749,31043113