SubtiBank SubtiBank
ahrC
The papers of the month are back! Check them out! Link here

ahrC

transcriptional regulator of the ArgR family, AhrC represses the genes for arginine biosynthesis and activates the genes for arginine catabolism
locus
BSU24250
pI
5.52
mw
16.69 kDa
protein length
149 aa Sequence Blast
gene length
447 bp Sequence Blast
function
transcriptional regulator of arginine metabolic genes
product
transcriptional regulator (ArgR family)
essential
no
synonyms
argR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,522,324 → 2,522,773

    Phenotypes of a mutant

  • increased intracellular concentration of ornithine, citrulline, and arginine [pubmed|28679749]
  • [gene|search|ahrC ]inactivation allows growth of a [gene|search|ktrA ][gene|search|ktrB ][gene|search|kimA ]mutant at low potassium concentration [pubmed|28679749]
  • The protein

    Catalyzed reaction/ biological activity

  • transcriptional activator/ repressor of genes involved in arginine metabolism
  • Protein family

  • [SW|ArgR family]
  • [SW|Cofactors]

  • L-arginine is the co-factor required for transcription repression/ activation
  • Structure

  • [PDB|2P5L] (complex with an 18bp DNA operator) [pubmed|18455186]
  • [PDB|2P5K] (N-terminus) [pubmed|18007039]
  • [PDB|2P5M] (C-Terminus) [pubmed|18007040]
  • [PDB|1F9N] [pubmed|11856827]
  • [SW|Localization]

  • Cytoplasm
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000043 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]-[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]
    description
    [Pubmed|2106508]

    regulation

  • by [protein|search|sRNA] [protein|search|sr1]
  • additional information

  • expression is fourfold increased upon depletion of ''[SW|nusA]'' [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    genes
    [gene|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs]-[gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]-[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]-[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Other regulations

  • [protein|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|Sr1]: translation inhibition, via binding to the ahrC mRNA
  • Biological materials

    Mutant

  • GP729 (ahrC::aphA3), available in [SW|Jörg Stülke]'s lab
  • GP2185 (Δ[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
  • BKE24250 (Δ[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGCACCTCTATTTC, downstream forward: _UP4_TAACAGAAAATCTAACAAAG
  • BKK24250 (Δ[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGCACCTCTATTTC, downstream forward: _UP4_TAACAGAAAATCTAACAAAG
  • Labs working on this gene/protein

  • [SW|Simon Phillips], Leeds University, UK [http://www.astbury.leeds.ac.uk/People/staffpage.php?StaffID=SEVP Homepage]
  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
  • References

  • 17020585,17576690,18455186,18007040,18007039,11856827,11305941,9383188,7565595,1312212,2106508,27171430,28679749