SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


RNA polymerase sigma factor SigO (with RsoA)
22.54 kDa
protein length
177 aa Sequence Blast
gene length
531 bp Sequence Blast
RNA polymerase sigma factor
co-sigma factor with RsoA

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • Gene

    3,409,462 → 3,409,992

    The protein


  • contains a DNA-binding helix-turn-helix motif (HTH) and the region 4.2 of Sigma factors [Pubmed|19940246]
  • Expression and Regulation



    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials


  • MGNA-B052 (yvrI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33230 (Δ[gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATCTCCTTAC, downstream forward: _UP4_CAAAAAAAGGGGGAAAAGTA
  • BKK33230 (Δ[gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATCTCCTTAC, downstream forward: _UP4_CAAAAAAAGGGGGAAAAGTA
  • Labs working on this gene/protein

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 18573182,19047353,26651345,16306698,19940246,26367498,26400263,27558998