SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|RNA polymerase] [SW|sigma factor] SigO (with [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA])
22.54 kDa
protein length
177 aa Sequence Blast
gene length
531 bp Sequence Blast
[SW|RNA polymerase] [SW|sigma factor]
co-sigma factor with [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • Gene

    3,409,462 → 3,409,992

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • [SW|Domains]

  • contains a DNA-binding helix-turn-helix motif (HTH) and the region 4.2 of Sigma factors [Pubmed|19940246]
  • Expression and Regulation



    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials


  • MGNA-B052 (yvrI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33230 (Δ[gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATCTCCTTAC, downstream forward: _UP4_CAAAAAAAGGGGGAAAAGTA
  • BKK33230 (Δ[gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATCTCCTTAC, downstream forward: _UP4_CAAAAAAAGGGGGAAAAGTA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 18573182,19047353,26651345,16306698,19940246,26367498,26400263,27558998