SubtiBank SubtiBank
cotV
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotV

spore crust protein (insoluble fraction), formation of the spore crust
locus
BSU_11780
pI
4.01
mw
14.09 kDa
protein length
128 aa Sequence Blast
gene length
387 bp Sequence Blast
function
resistance of the spore
product
spore crust protein (insoluble fraction)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    1,251,631 1,252,017

    The protein

    [SW|Localization]

  • spore crust [pubmed|28870294]
  • Expression and Regulation

    Operons

    genes
    [gene|63870866AA2EA1727D77609B330FCD9704007679|cotV]-[gene|47669BC8073FB0F9799E06BB9FC39700F960910E|cotW]-[gene|905148CAF82018E7F8E800FDF3F41163AAA8E682|cotX]
    description
    [Pubmed|7519271]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,7519271], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7519271,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE11780 ([gene|63870866AA2EA1727D77609B330FCD9704007679|cotV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCTTCACTCCTTTCT, downstream forward: _UP4_TAACCCTTTCTTTTCACAAA
  • BKK11780 ([gene|63870866AA2EA1727D77609B330FCD9704007679|cotV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCTTCACTCCTTTCT, downstream forward: _UP4_TAACCCTTTCTTTTCACAAA
  • References

  • 7519271,19304857,21665972,12107147,25872412,28870294,30582883