SubtiBank SubtiBank
yfmS
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfmS

soluble chemotaxis receptor
locus
BSU_07360
pI
4.53
mw
30.17 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
function
control of chemotaxis
product
soluble chemotaxis receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.3|Soluble chemoreceptors]
  • Gene

    Coordinates
    808,562 809,422

    The protein

    [SW|Domains]

  • [SW|Methyl-accepting transducer domain] (aa 68-268) (according to UniProt)
  • Structure

  • [PDB|2CH7] (from Thermotoga maritima, corresponds to aa 167 ... 281, 39% identity) [pubmed|16622408]
  • [SW|Localization]

  • forms clusters at the cell poles [Pubmed|21515776]
  • Expression and Regulation

    Operons

    genes
    [gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]-[gene|63BCB42FC501B57ABC9FF252AC5D04BB729EA6B9|yfmS]
    description
    [Pubmed|9141694,15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, YfmS is present with 4,200 +/- 800 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C233 (yfmS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2231 NBRP B. subtilis, Japan]
  • BKE07360 ([gene|63BCB42FC501B57ABC9FF252AC5D04BB729EA6B9|yfmS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCAATTCCATTCACTCCT, downstream forward: _UP4_TAAGAGACCGGGGACAAACA
  • BKK07360 ([gene|63BCB42FC501B57ABC9FF252AC5D04BB729EA6B9|yfmS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCAATTCCATTCACTCCT, downstream forward: _UP4_TAAGAGACCGGGGACAAACA
  • References

  • 9141694,15033535,21515776,16622408