SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to acyl-CoA dehydrogenase
7.37 kDa
protein length
gene length
192 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,155,058 2,155,249

    The protein

    Paralogous protein(s)

  • [protein|F25CDDEBAFC72036664323619F5197D45E86BE9A|MmgC]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25299644], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|25299644], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|6977F18870004AD236539D9409255815E6BE9241|CsoR]: repression, [Pubmed|20233928], in [regulon|6977F18870004AD236539D9409255815E6BE9241|CsoR regulon]
  • regulation

  • ''[protein|search|sprB]'': expressed during the middle and late stages of [SW|sporulation] [Pubmed|25299644]
  • view in new tab

    Biological materials


  • BKE19930 ([gene|6416197EF316D74998012765EF9819072C38D2E2|yotC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCCCCTTCCCTTCT, downstream forward: _UP4_TAGATAAAATGTTGAATTTA
  • BKK19930 ([gene|6416197EF316D74998012765EF9819072C38D2E2|yotC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCCCCTTCCCTTCT, downstream forward: _UP4_TAGATAAAATGTTGAATTTA
  • References

  • 25299644,9387222,27766092