SubtiBank SubtiBank
glnR
The papers of the month are back! Check them out! Link here

glnR

transcriptional repressor ([SW|MerR family]) of the [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|search|glnA ]operon
locus
BSU17450
pI
9.73
mw
15.69 kDa
protein length
135 aa Sequence Blast
gene length
405 bp Sequence Blast
function
regulation of glutamine synthesis
product
transcription repressor ([SW|MerR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,877,959 → 1,878,366

    The protein

    Protein family

  • [SW|MerR family]
  • [SW|Cofactors]

  • feedback-inhibited [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA] [Pubmed|18195355]
  • Effectors of protein activity

  • activity is enhanced upon interaction of the C-terminal domain with [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA] [Pubmed|18331450]
  • Structure

  • [PDB|4R4E] (the GlnR-DNA complex) [Pubmed|25691471]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000027 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]
    description
    [Pubmed|8636055]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2906311], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, in complex with [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • regulation

  • expressed in the absence of glutamine ([protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]) [Pubmed|8636055]
  • the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    genes
    [gene|9F6B78C1932FB56F7F71430DB16BC862A312407B|ynbA]-[gene|14EFA3BF4E5DD5368EF02B0733300CEF7A4E0DC7|ynbB]-[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]
    description
    [Pubmed|22383849]

    regulation

  • the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    genes
    [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2906311], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, in complex with [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BP148 (del(''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]'')::''cat''), available in [SW|Fabian Commichau]'s lab
  • BKE17450 (Δ[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAATTTCCTCCTTTT, downstream forward: _UP4_TAATCCGTTAGCAACTGTTT
  • BKK17450 (Δ[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAATTTCCTCCTTTT, downstream forward: _UP4_TAATCCGTTAGCAACTGTTT
  • lacZ fusion

  • pGP189 (in [protein|search|pAC7]), available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Susan Fisher], Boston, USA [http://www.bumc.bu.edu/microbiology/research/susan-h-fisher-phd/ homepage]
  • References

    Reviews

  • 22625175
  • Original publications

  • 12374841,9287005,8799114,18195355,2573733,8636055,19233925,2906311,18331450,16547045,23535029,25691471,25755103,26883633,28835263,29794222