SubtiBank SubtiBank
ybaK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybaK

sporulation protein
locus
BSU_01520
pI
5.00
mw
17.51 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
unknown
product
sporulation protein
essential
no
synonyms
ybxH

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    156,109 156,552

    Expression and Regulation

    Operons

    genes
    [gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]-[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]
    description
    [Pubmed|7559346]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,7559346], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigG]) [Pubmed|7559346]
  • view in new tab

    Biological materials

    Mutant

  • BKE01520 ([gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAATTCACTCTCCTT, downstream forward: _UP4_TAATCATATTTCCCGACCCT
  • BKK01520 ([gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAATTCACTCTCCTT, downstream forward: _UP4_TAATCATATTTCCCGACCCT
  • References

  • 7559346,16267290