SubtiBank SubtiBank
gmuR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gmuR

transcriptional repressor (GntR family) of the gmuB-gmuA-gmuC-gmuD-gmuR-gmuE-gmuF-gmuG operon
locus
BSU_05850
pI
7.44
mw
27.23 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
function
regulation of glucomannan utilization
product
transcriptional repressor (GntR family)
essential
no
synonyms
ydhQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.25|Utilization of glucomannan]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    630,170 630,883

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 1-69) (according to UniProt)
  • Structure

  • [PDB|2WV0] (the structure of [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR], 29% identity) [Pubmed|20047956]
  • Expression and Regulation

    Operons

    genes
    [gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
    description
    [Pubmed|18177310]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C192 (ydhQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2190 NBRP B. subtilis, Japan]
  • BKE05850 ([gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTATCCTCCGGCAGC, downstream forward: _UP4_TGATTGCGGAGACAACAAGG
  • BKK05850 ([gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTATCCTCCGGCAGC, downstream forward: _UP4_TGATTGCGGAGACAACAAGG
  • References

  • 18177310,10627040,18177310,20817675,20047956