SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor (GntR family) of the gmuB-gmuA-gmuC-gmuD-gmuR-gmuE-gmuF-gmuG operon
27.23 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
regulation of glucomannan utilization
transcriptional repressor (GntR family)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucomannan]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    630,170 630,883

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Structure

  • [PDB|2WV0] (the structure of [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR], 29% identity) [Pubmed|20047956]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials


  • MGNA-C192 (ydhQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05850 ([gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTATCCTCCGGCAGC, downstream forward: _UP4_TGATTGCGGAGACAACAAGG
  • BKK05850 ([gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTATCCTCCGGCAGC, downstream forward: _UP4_TGATTGCGGAGACAACAAGG
  • References

  • 18177310,10627040,18177310,20817675,20047956