SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ß-hydroxyacyl-(acyl carrier protein) dehydratase
14.11 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
fatty acid biosynthesis
ß-hydroxyacyl-ACP dehydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of fatty acids]
  • Gene

    455,346 455,738

    The protein

    Protein family

  • thioester dehydratase family (with [protein|BDA23FA513C240B07DC109BB62A7A5EB96B20965|YwpB], according to UniProt)
  • Paralogous protein(s)

  • [protein|BDA23FA513C240B07DC109BB62A7A5EB96B20965|YwpB]
  • Structure

  • [PDB|4I83]((3r)-hydroxymyristoyl-ACP dehydratase from Neisseria meningitidis, 34% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C021 (ycsD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04030 ([gene|65506215AE58BF53C57599E566E4F78514DB45AA|ycsD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATATCTCCTTTTTT, downstream forward: _UP4_TGAAAAAAACCCTTCACAAC
  • BKK04030 ([gene|65506215AE58BF53C57599E566E4F78514DB45AA|ycsD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATATCTCCTTTTTT, downstream forward: _UP4_TGAAAAAAACCCTTCACAAC
  • References

  • 17919287