SubtiBank SubtiBank
yesW
The papers of the month are back! Check them out! Link here

yesW

rhamnogalacturonan lyase, generates oligosaccharides
locus
BSU07050
pI
5.97
mw
67.41 kDa
protein length
620 aa Sequence Blast
gene length
1860 bp Sequence Blast
function
utilization of rhamnogalacturonan
product
rhamnogalacturonan lyase, generates oligosaccharides
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • Gene

    Coordinates
    770,234 → 772,096

    The protein

    Protein family

  • FG-GAP repeat (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
  • Structure

  • [PDB|2Z8R]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
    description
    [Pubmed|19651770]

    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials

    Mutant

  • BKE07050 (Δ[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTGTAAGCGCTTA, downstream forward: _UP4_TAACTGAAAGGGGGAAGGAA
  • BKK07050 (Δ[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTGTAAGCGCTTA, downstream forward: _UP4_TAACTGAAAGGGGGAAGGAA
  • References

    Reviews

  • 26255130
  • Original publications

  • 19651770,17449691,17947240,19193638,16682770