SubtiBank SubtiBank
yesW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yesW

rhamnogalacturonan lyase, generates oligosaccharides
locus
BSU_07050
pI
5.97
mw
67.41 kDa
protein length
620 aa Sequence Blast
gene length
1863 bp Sequence Blast
function
utilization of rhamnogalacturonan
product
rhamnogalacturonan lyase, generates oligosaccharides
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • Gene

    Coordinates
    770,234 772,096

    The protein

    Catalyzed reaction/ biological activity

  • Endotype eliminative cleavage of L-alpha-rhamnopyranosyl-(1->4)-alpha-D-galactopyranosyluronic acid bonds of rhamnogalacturonan I domains in ramified hairy regions of pectin leaving L-rhamnopyranose at the reducing end and 4-deoxy-4,5-unsaturated D-galactopyranosyluronic acid at the non-reducing end (according to UniPort)
  • Protein family

  • polysaccharide lyase 11 family (with [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX], according to UniProt)
  • Paralogous protein(s)

  • [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
  • Structure

  • [PDB|2Z8R]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
    description
    [Pubmed|19651770]

    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials

    Mutant

  • BKE07050 ([gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTGTAAGCGCTTA, downstream forward: _UP4_TAACTGAAAGGGGGAAGGAA
  • BKK07050 ([gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTGTAAGCGCTTA, downstream forward: _UP4_TAACTGAAAGGGGGAAGGAA
  • References

    Reviews

  • 26255130
  • Original publications

  • 19651770,17449691,17947240,19193638,16682770