SubtiBank SubtiBank
yoaQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yoaQ

unknown
locus
BSU_18700
pI
4.81
mw
13.52 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,040,673 2,041,029

    Biological materials

    Mutant

  • BKE18700 ([gene|6570E3A80C291C172B82946F2FAD9F1B4D3F990F|yoaQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTTAATTCCCCTTTTA, downstream forward: _UP4_AAAACTAAATCTTGACATAG
  • BKK18700 ([gene|6570E3A80C291C172B82946F2FAD9F1B4D3F990F|yoaQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTTAATTCCCCTTTTA, downstream forward: _UP4_AAAACTAAATCTTGACATAG