SubtiBank SubtiBank
ydfR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydfR

unknown
locus
BSU_05530
pI
10.37
mw
25.02 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    600,229 600,906

    The protein

    Protein family

  • [SW|UPF0702 family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|65EAA88A18FD7E11ED7ACAF8026E088ACD9EA303|ydfR]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|16497325]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C155 (ydfR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2153 NBRP B. subtilis, Japan]
  • BKE05530 ([gene|65EAA88A18FD7E11ED7ACAF8026E088ACD9EA303|ydfR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTCCTGAACCGAAC, downstream forward: _UP4_TAACAAAAGGCGCTTGTGGC
  • BKK05530 ([gene|65EAA88A18FD7E11ED7ACAF8026E088ACD9EA303|ydfR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTCCTGAACCGAAC, downstream forward: _UP4_TAACAAAAGGCGCTTGTGGC
  • References

  • 16497325,30792386