SubtiBank SubtiBank
licB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

licB

lichenan-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR] activity
locus
BSU_38590
pI
6.31
mw
10.82 kDa
protein length
102 aa Sequence Blast
gene length
309 bp Sequence Blast
function
lichenan uptake and phosphorylation, control of LicR activity
product
lichenan-specific [category|SW 1.2.2|PTS], EIIB component
essential
no
ec
2.7.1.69
synonyms
celA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,961,566 3,961,874

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, lactose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|00A4A90685CED4AD46829C45718CF26F1D62F5D3|GmuB]
  • Modification

  • phosphorylation on Ser-37 [Pubmed|17218307]
  • Structure

  • [PDB|1e2b] (from ''E. coli'', 40% identity) [Pubmed|9041631]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8990303], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8990303], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR]: activation, [Pubmed|8990303], in [regulon|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
  • view in new tab

    Biological materials

    Mutant

  • BKE38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA, downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
  • BKK38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA, downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
  • References

  • 19087206,8990303,16872404,10438772,10627040,17218307,8990303,9041631