SubtiBank SubtiBank
yxjI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxjI

unknown
locus
BSU_38940
pI
4.47
mw
18.68 kDa
protein length
162 aa Sequence Blast
gene length
489 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,997,221 3,997,709

    The protein

    Protein family

  • LOR family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|660443DFA2D175758677E4F88A2CEEC3BB5A2399|yxjI]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    genes
    [gene|F4C0A4050414B2FC9D6E571419D9537707DA4C05|yxjJ]-[gene|660443DFA2D175758677E4F88A2CEEC3BB5A2399|yxjI]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B799 (yxjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1798 NBRP B. subtilis, Japan]
  • BKE38940 ([gene|660443DFA2D175758677E4F88A2CEEC3BB5A2399|yxjI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTGAAGTCTCCTTTG, downstream forward: _UP4_TAAAAAGCATTGACAATTGA
  • BKK38940 ([gene|660443DFA2D175758677E4F88A2CEEC3BB5A2399|yxjI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTGAAGTCTCCTTTG, downstream forward: _UP4_TAAAAAGCATTGACAATTGA
  • References

  • 16672620,15805528