SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


export of extracellular poly-N-acetylglucosamine
55.00 kDa
protein length
505 aa Sequence Blast
gene length
1518 bp Sequence Blast
export of extracellular poly-N-acetylglucosamine
poly-N-acetylglucosamine exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,517,485 3,519,002

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • The protein

    Protein family

  • [SW|MOP exporter family]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541]
  • expression is increased in [gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX] mutants [pubmed|32483306]
  • view in new tab

    Biological materials


  • MGNA-B611 (yvfA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34265 ([gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCGCTGAAATTTATCGTGA, downstream forward: _UP4_AAAACGAAAGGAGCTGTGAA
  • BKK34265 ([gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCGCTGAAATTTATCGTGA, downstream forward: _UP4_AAAACGAAAGGAGCTGTGAA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References


  • 20735481
  • The EAR [SW|RNA switch]

  • 20374491,20230605