SubtiBank SubtiBank
yybS
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yybS

unknown
locus
BSU_40520
pI
9.95
mw
34.38 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,165,659 4,166,588

    Expression and Regulation

    Operons

    genes
    [gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]-[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]-[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
    description
    [Pubmed|22383849]

    additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yybS'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B835 (yybS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1834 NBRP B. subtilis, Japan]
  • BKE40520 ([gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTAGTCACCTCGTATCA, downstream forward: _UP4_TGAACATGAGTTTTACTCAC
  • BKK40520 ([gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTAGTCACCTCGTATCA, downstream forward: _UP4_TGAACATGAGTTTTACTCAC
  • References

  • 20525796,27120414