SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|ABC transporter] ( membrane protein)
47.14 kDa
protein length
408 aa Sequence Blast
gene length
1227 bp Sequence Blast
regulation of the secretion apparatus and of intra-membrane proteolysis
[SW|ABC transporter] ( membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Regulatory ABC transporters]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,078,176 1,079,402

    Phenotypes of a mutant

  • inactivation of ''[gene|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|ecsB]'' reduces sporulation efficiency to 13.4% that of wild type cells [Pubmed|26735940]
  • no processing of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] and [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|FtsL], impaired activity of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] [pubmed|29343670]
  • The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • BKE10050 ([gene|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|ecsB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGCGACTGCCAAATATCAA, downstream forward: _UP4_CTGTGAACTGAAAAGAGGTA
  • BKK10050 ([gene|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|ecsB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGCGACTGCCAAATATCAA, downstream forward: _UP4_CTGTGAACTGAAAAGAGGTA
  • References


  • 29343670
  • Original publications

  • 8581172,15175311,10092453,18599827,10027970,12884008,26735940