SubtiBank SubtiBank
ytmB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytmB

unknown
locus
BSU_30570
pI
7.03
mw
9.13 kDa
protein length
gene length
243 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,131,152 3,131,394

    The protein

    Structure

  • [PDB|2NWA]
  • Expression and Regulation

    Operons

    genes
    [gene|669D29CFF067DD7E59A722561BDBD2FBA4145A2F|ytmB]
    description
    [Pubmed|9387221]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A303 (ytmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/303 NBRP B. subtilis, Japan]
  • BKE30570 ([gene|669D29CFF067DD7E59A722561BDBD2FBA4145A2F|ytmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGTGAAATCCCCTTTCG, downstream forward: _UP4_TAAAACAAGCCAAGAGCATA
  • BKK30570 ([gene|669D29CFF067DD7E59A722561BDBD2FBA4145A2F|ytmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGTGAAATCCCCTTTCG, downstream forward: _UP4_TAAAACAAGCCAAGAGCATA
  • References

  • 9387221