SubtiBank SubtiBank
thdF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

thdF

GTP-binding protein, putative tRNA modification GTPase
locus
BSU_41020
pI
4.64
mw
50.81 kDa
protein length
459 aa Sequence Blast
gene length
1380 bp Sequence Blast
function
tRNA modification
product
putative tRNA modification GTPase
essential
no
synonyms
mnmE,trmE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    Coordinates
    4,211,510 4,212,889

    Phenotypes of a mutant

  • inactivation of ''[gene|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|thdF]'' reduces sporulation efficiency to 21.9% that of wild type cells; longer mother cells, some with aberrant septa and forespores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • Binds and hydrolyzes GTP and readily exchanges GDP for GTP
  • Protein family

  • [SW|TRAFAC class TrmE-Era-EngA-EngB-Septin-like GTPase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg], [protein|959C0ED7B9DA50F0EADCF1565405B878D36DA206|YqeH], [protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|YnbA], [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|YphC], [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|YyaF], [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|Era], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|YsxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA]
  • [SW|Domains]

  • TrmE-type G domain (aa 221-380) (according to UniProt)
  • Structure

  • [PDB|1XZP] (from ''Thermotoga maritima'', 44% identity) [Pubmed|15616586]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • Information on the corresponding protein from ''E. coli'': [http://BioCyc.org/ECOLI/NEW-IMAGE?type=ENZYME&object=EG10997-MONOMER EcoCyc]
  • MnmE required for wild-type 5-methylaminomethyl-2-thiouridine modification of tRNA, interacts with [protein|7809B4F5B9172EBB6C91BDE7B673FB08E82763FF|GidA]. MnmE also appears to play a role in oxidation of thiophene and furan compounds and regulates glutamate-dependent acid resistance.
  • Expression and Regulation

    Operons

    genes
    [gene|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|thdF]-[gene|7809B4F5B9172EBB6C91BDE7B673FB08E82763FF|gidA]-[gene|CCB7EE1D049585979303148FBDE0D42549E648DE|gidB]-[gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]
    description
    [Pubmed|11807071]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B877 (thdF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1876 NBRP B. subtilis, Japan]
  • BKE41020 ([gene|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|thdF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE41020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTTCACCTCTCTTT, downstream forward: _UP4_TAATTAAAGGAGGAACTAGA
  • BKK41020 ([gene|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|thdF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK41020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTTCACCTCTCTTT, downstream forward: _UP4_TAATTAAAGGAGGAACTAGA
  • labs

  • [SW|Naotake Ogasawara], Nara, Japan
  • References

    Reviews

  • 21885683,26832457
  • Original publications

  • 12427945,11807071,11948146,23630314,26020636,15616586,26735940