SubtiBank SubtiBank
yflN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yflN

similar to metallo-beta-lactamase
locus
BSU_07620
pI
5.07
mw
28.68 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    835,740 836,534

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Structure

  • [PDB|4AWY] (from Pseudomonas aeruginosa, 25% identity) [pubmed|22664968]
  • Expression and Regulation

    Operons

    genes
    [gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]-[gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]
    description
    [Pubmed|10972810]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10972810], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|CitT]: activation, [Pubmed|10972810], in [regulon|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|CitT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538,10972810], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by citrate ([protein|search|CitT]) [Pubmed|10972810]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C253 (yflN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2251 NBRP B. subtilis, Japan]
  • BKE07620 ([gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGACACCTCCGGAAT, downstream forward: _UP4_TGACACCCGCACCACGCGGG
  • BKK07620 ([gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGACACCTCCGGAAT, downstream forward: _UP4_TGACACCCGCACCACGCGGG
  • References

  • 10972810,22664968