SubtiBank SubtiBank
yflN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yflN

similar to metallo-beta-lactamase
locus
BSU_07620
pI
5.07
mw
28.68 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    835,740 836,534

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Structure

  • [PDB|4AWY] (from Pseudomonas aeruginosa, 25% identity) [pubmed|22664968]
  • Expression and Regulation

    Operons

    genes
    [gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]-[gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]
    description
    [Pubmed|10972810]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10972810], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|CitT]: activation, [Pubmed|10972810], in [regulon|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|CitT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538,10972810], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by citrate ([protein|search|CitT]) [Pubmed|10972810]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C253 (yflN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2251 NBRP B. subtilis, Japan]
  • BKE07620 ([gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGACACCTCCGGAAT, downstream forward: _UP4_TGACACCCGCACCACGCGGG
  • BKK07620 ([gene|66B9809A77AB15E5C8C8E5A8E26752771AF55E3A|yflN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGACACCTCCGGAAT, downstream forward: _UP4_TGACACCCGCACCACGCGGG
  • References

  • 10972810,22664968