SubtiBank SubtiBank
ydhF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydhF

unknown
locus
BSU_05730
pI
6.16
mw
26.38 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    619,321 620,031

    The protein

    [SW|Domains]

  • [SW|DUF4352] (aa 84 ... 190) (according to UniProt)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], lipid modification as retention signal
  • Expression and Regulation

    Operons

    genes
    [gene|3B95AB3021280215B6B487A348D78FB5797AEEA6|phoB]-[gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]
    description
    [Pubmed|10913081]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,16030210], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9335276,10913081,16030210], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|9335276,10913081,16030210]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C181 (ydhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2179 NBRP B. subtilis, Japan]
  • BKE05730 ([gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCCTCCATTAA, downstream forward: _UP4_TAAATCAAGAACTCCCGTAC
  • BKK05730 ([gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCCTCCATTAA, downstream forward: _UP4_TAAATCAAGAACTCCCGTAC
  • References

  • 16030210,9335276,10913081,18957862